Community Profile

Meghashree G


Active since 2015


  • First Review
  • Thankful Level 2
  • First Answer

View badges

Content Feed

View by

How do you segment the image horizontally?
Hello sir, i used your code for line segmentation ,but for the below form its not working!! what changes should i make in order...

5 years ago | 0


How to thin the image so as to make the thickness of the image to one pixel wide?
Hello,i have an image and i want to thin that word image so as to make the thickness of each word to one-pixel wide to make the...

6 years ago | 2 answers | 0




how to put bounding box for single letter image?
Hello, i have a single letter image and if i apply bounding for it,i am getting only one box. <</matlabcentral/answers/upload...

6 years ago | 1 answer | 0




Error using stem (line 44) X must be same length as Y while using eigen values.
Hello, i am trying to recognize the characters using eigen values concept, but im getting the following error. Error using...

6 years ago | 1 answer | 0




how to segment/crop words from a line in an image in matlab?
Hello, Im trying to segment/crop words from the line in an image.(this line is obtained by segmenting line from paragraph) H...

6 years ago | 3 answers | 0




How to segment handwritten cursive characters using vertical projection profile??
Hello, I need to segment the cursive handwritten characters.for this i'm first doing preprocessing.i.e.COMPLEMENT OF BINARY WIT...

6 years ago | 0 answers | 0




How to skew the line which is in the image?
<</matlabcentral/answers/uploaded_files/42099/thirdline.jpg>> i have this slant line to appear straight!how do i achieve this...

6 years ago | 1 answer | 0




how to obtain the gray level values of the image pixels??
I'm doing handwriting analysis,for that one feature is to identify the pressure.For the analysis of pen pressure, Mean gray leve...

6 years ago | 1 answer | 0




how to obtain the space between two words in a given sentence?
<</matlabcentral/answers/uploaded_files/41988/secondline.png>> Hello, I want to obtain the space between the two words in th...

6 years ago | 2 answers | 1




How to segment an image containing text?
I have an image containing paragraph,how do i segment that paragraph into separate lines?? i mean the paragraph should be segmen...

6 years ago | 1 answer | 0




DNA encryption algorithm-cryptography
I am implementing DNA encryption algorithm: This is what i'm doing..Taking the user input converting it to ATGC format and se...

6 years ago | 1 answer | 0




Which is better?converting hexadecimal to string directly or first converting hexa to decimal and then from decimal to string?
i have a variable containing hex,now it should be converted to string..How do i do that? Please note...

6 years ago | 1 answer | 0




convert hexadecimal to string
i have con = 63727970746F,that is hexadecimal code..When converted to string it should give crypto..How to code for this? con w...

6 years ago | 2 answers | 0




converting binary to hexadecimal
bin_str = input('Enter binary number: ', 's'); i = length(bin_str); disp(i); n = ceil(i/4); disp(n); for g = ...

6 years ago | 2 answers | 0




How to send an array from client to server ?
I am implementing cryptographic algorithm(DNA encryption algorithm).for that i'm using 2 matlab terminals,one acting as client a...

6 years ago | 2 answers | 0



send data from one computer to an other computer using matlab via internet.
Hi i want to send array from one matlab terminal to other! how do i do that? Please help me Refer the below link pls: <...

6 years ago | 0


Encoding Binary to DNA sequencing
I am trying to convert the string into binary and sequencing with DNA,but i am getting error as follows : Attempted to acc...

6 years ago | 1 answer | 0




Decoding DNA sequence into binary
I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you

6 years ago | 4 answers | 0




Binary to DNA sequence encoding - matlab
I am implementing DNA encryption algorithm. For that, I have a vector containing binary values such as: 01100011 01110...

6 years ago | 1 answer | 0

