Binary to DNA sequence encoding - matlab
7 views (last 30 days)
Show older comments
Meghashree G
on 20 Sep 2015
Commented: Image Analyst
on 5 Feb 2021
I am implementing DNA encryption algorithm.
For that, I have a vector containing binary values such as:
01100011 01110010 01111001 01110000 01110100 01101111.
Now, these values should be mapped to DNA sequence. How do I do that in MATLAB?
2 Comments
Star Strider
on 20 Sep 2015
DNA has four bases (two complementary sets, A-T and C-G) and you have a binary sequence ...
Accepted Answer
Image Analyst
on 20 Sep 2015
Perhaps this:
% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
% Convert these two digits into a number 1 - 4.
index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
% Use that index to assign a letter to our result.
result((k+1)/2) = bases(index);
end
% Display in command window:
result
It shows:
result =
TGACTCAGTCGTTCAATCTATGCC
12 Comments
Image Analyst
on 5 Feb 2021
Shiva, I'm not sure who you're asking, but personally I don't have any to give you.
More Answers (0)
See Also
Categories
Find more on Directed Graphs in Help Center and File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!