Binary to DNA sequence encoding - matlab

15 views (last 30 days)
I am implementing DNA encryption algorithm.
For that, I have a vector containing binary values such as:
01100011 01110010 01111001 01110000 01110100 01101111.
Now, these values should be mapped to DNA sequence. How do I do that in MATLAB?
  2 Comments
Star Strider
Star Strider on 20 Sep 2015
DNA has four bases (two complementary sets, A-T and C-G) and you have a binary sequence ...
Meghashree G
Meghashree G on 20 Sep 2015
yeah..i know To use ATGC concept,but i don't know how to code..Like how do i extract only 2 digits from the binary vector and assign it to either A,T,G,C..

Sign in to comment.

Accepted Answer

Image Analyst
Image Analyst on 20 Sep 2015
Perhaps this:
% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
% Convert these two digits into a number 1 - 4.
index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
% Use that index to assign a letter to our result.
result((k+1)/2) = bases(index);
end
% Display in command window:
result
It shows:
result =
TGACTCAGTCGTTCAATCTATGCC
  12 Comments
Shiva Reddy
Shiva Reddy on 5 Feb 2021
Pls Can I get the decryption code
Image Analyst
Image Analyst on 5 Feb 2021
Shiva, I'm not sure who you're asking, but personally I don't have any to give you.

Sign in to comment.

More Answers (0)

Categories

Find more on Cell Arrays in Help Center and File Exchange

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!