
Problem 79. DNA N-Gram Distribution

Solution 126262

Submitted on 10 Aug 2012 by Freddy
This solution is locked. To view this solution, you need to provide a solution of the same size or smaller.

Test Suite

Test Status Code Input and Output
1   Pass
%% s = 'AACTGAACG'; n = 3; hifreq_correct = 'AAC'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

{Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.} {> In hankel at 27 In nGramFrequency at 2 In verifyCode>evaluateCode at 189 In verifyCode at 37 In fevalJSON at 14}

2   Pass
%% s = 'dynamic routing service'; n = 2; hifreq_correct = 'ic'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

{Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.} {> In hankel at 27 In nGramFrequency at 2 In verifyCode>evaluateCode at 189 In verifyCode at 37 In fevalJSON at 14}

3   Pass
%% s = 'Your veracity is exceeded by your sagacity.'; n = 5; hifreq_correct = 'acity'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

{Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.} {> In hankel at 27 In nGramFrequency at 2 In verifyCode>evaluateCode at 189 In verifyCode at 37 In fevalJSON at 14}

4   Pass
%% s = 'AGCGAAGGAAGGATCACATTTCTCAGGACAAAGGCATTTCACTAATGGTT'; n = 3; hifreq_correct = 'AGG'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

{Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.} {> In hankel at 27 In nGramFrequency at 2 In verifyCode>evaluateCode at 189 In verifyCode at 37 In fevalJSON at 14}

5   Pass
%% s = 'In short, in matters vegetable, animal, and mineral, I am the very model of a modern Major-General.'; n = 2; hifreq_correct = 'er'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

{Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.} {> In hankel at 27 In nGramFrequency at 2 In verifyCode>evaluateCode at 189 In verifyCode at 37 In fevalJSON at 14}