DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers4
Suggested Problems
-
6992 Solvers
-
What is the distance from point P(x,y) to the line Ax + By + C = 0?
560 Solvers
-
Find the elements of a matrix according to a defined property.
92 Solvers
-
Calculate a modified Levenshtein distance between two strings
141 Solvers
-
658 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
