nt2aa
Convert nucleotide sequence to amino acid sequence
Description
Examples
Generate a random DNA sequence.
ntSeq = randseq(30)
ntSeq = 'TTATGACGTTATTCTACTTTGATTGTGCGA'
Convert the DNA sequence to an amino acid sequence using the standard genetic code.
aaSeq = nt2aa(ntSeq)
aaSeq = 'L*RYSTLIVR'
Generate amino acid sequences for all three reading frames using the yeast mitochondrial genetic code.
aaSeq = nt2aa(ntSeq,Frame="all",GeneticCode=3)aaSeq = 3×1 cell
    {'LWRYSTLIVR'}
    {'YDVITTWLC' }
    {'MTLFYFDCA' }
Input Arguments
Nucleotide sequence, specified as one of the following.
- Character vector or string scalar consisting of the characters - A,- C,- G,- T, and- U, and ambiguous characters- R,- Y,- K,- M,- S,- W,- B,- D,- H,- V, and- N.
- Row vector of integers specifying a nucleotide sequence. For information on valid integers, see Mapping Nucleotide Integers to Letter Codes. 
- Structure that contains a nucleotide sequence in the - Sequencefield. The- fastaread,- fastqread,- emblread,- getembl,- genbankread, and- getgenbankfunctions return structures with a- Sequencefield.
Note
- Hyphens are valid only if the codon to which it belongs represents a gap, that is, the codon contains all hyphens. For example, - ACT---TGA.
- Do not use a sequence with hyphens if you specify - "all"for- Frame.
Example: SeqAA = nt2aa("CGACTT") converts the nucleotide sequence
            to the amino acid sequence 'RL'.
Data Types: double | char | string | struct
Name-Value Arguments
Specify optional pairs of arguments as
      Name1=Value1,...,NameN=ValueN, where Name is
      the argument name and Value is the corresponding value.
      Name-value arguments must appear after other arguments, but the order of the
      pairs does not matter.
    
Example: SeqAA = nt2aa("CGACTT",Frame=2)
Reading frame, specified as 1, 2,
                3, or "all". If you specify
                "all", the function outputs a 3-by-1 cell array containing the
              amino acid sequences for all three reading frames.
Example: SeqAA = nt2aa("AAGACT",Frame=3) converts the nucleotide
              sequence to an amino acid sequence using the third reading frame.
Data Types: double | char | string
Genetic code number or name, specified as an integer, character vector, or string scalar. This table lists valid genetic code numbers and names.
| Genetic Code Number | Genetic Code Name | 
|---|---|
| 1 | Standard | 
| 2 | Vertebrate Mitochondrial | 
| 3 | Yeast Mitochondrial | 
| 4 | Mold,Protozoan,Coelenterate Mitochondrial, andMycoplasma/Spiroplasma | 
| 5 | Invertebrate Mitochondrial | 
| 6 | Ciliate,Dasycladacean, andHexamita Nuclear | 
| 9 | Echinoderm Mitochondrial | 
| 10 | Euplotid Nuclear | 
| 11 | BacterialandPlant Plastid | 
| 12 | Alternative Yeast Nuclear | 
| 13 | Ascidian Mitochondrial | 
| 14 | Flatworm Mitochondrial | 
| 15 | Blepharisma Nuclear | 
| 16 | Chlorophycean Mitochondrial | 
| 21 | Trematode Mitochondrial | 
| 22 | Scenedesmus Obliquus Mitochondrial | 
| 23 | Thraustochytrium Mitochondrial | 
Tip
If you use a code name, you can truncate the name to the first two letters of the name.
This table shows the nucleotide codon to amino acid mapping for the standard genetic code.
| Amino Acid Name | Amino Acid Code | Nucleotide Codon | 
|---|---|---|
| Alanine | A | GCT GCC GCA GCG | 
| Arginine | R | CGT CGC CGA CGG AGA AGG | 
| Asparagine | N | AAT AAC | 
| Aspartic acid (Aspartate) | D | GAT GAC | 
| Cysteine | C | TGT TGC | 
| Glutamine | Q | CAA CAG | 
| Glutamic acid (Glutamate) | E | GAA GAG | 
| Glycine | G | GGT GGC GGA GGG | 
| Histidine | H | CAT CAC | 
| Isoleucine | I | ATT ATC ATA | 
| Leucine | L | 
 † indicates an alternative
                        start codon for the standard genetic code as defined here. If you are using  | 
| Lysine | K | AAA AAG | 
| Methionine | M | ATG | 
| Phenylalanine | F | TTT TTC | 
| Proline | P | CCT CCC CCA CCG | 
| Serine | S | TCT TCC TCA TCG AGT AGC | 
| Threonine | T | ACT ACC ACA ACG | 
| Tryptophan | W | TGG | 
| Tyrosine | Y | TAT TAC | 
| Valine | V | GTT GTC GTA GTG | 
| Asparagine or Aspartic acid (Aspartate) | B | Random codon from DandN | 
| Glutamine or Glutamic acid (Glutamate) | Z | Random codon from EandQ | 
| Unknown amino acid (any amino acid) | X | Random codon | 
| Translation stop | * | TAA TAG TGA | 
| Gap of indeterminate length | - | --- | 
| Unknown character (any character or symbol not in table) | ? | ??? | 
Example: SeqAA = nt2aa("ACGTTA",GeneticCode=2) converts the
              nucleotide sequence using the vertebrate mitochondrial genetic code.
Data Types: double | char | string
Flag to translate alternative start codons, specified as true
              or false. When true, if the first codon of a
              sequence is a known alternative start codon, the function translates the codon to
              methionine (M). When false, the function
              translates the alternative start codon to its corresponding amino acid.
For more information on alternative start codons, visit https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=t#SG1.
            
Example: SeqAA = nt2aa("TTGATC",AlternativeStartCodons=true)
              converts the first codon to methionine (M) instead of leucine
                (L).
Data Types: logical
Flag to control the behavior of ambiguous nucleotides (R,
                Y, K, M,
                S, W, B,
                D, H, V, and
                N), specified as true or
                false. If you specify true, the function
              produces an error if any ambiguous nucleotides are present. If you specify
                false, the function tries to resolve any ambiguities. If it
              cannot, the function returns X for the affected codon.
Data Types: logical
Output Arguments
Amino acid sequence, specified as one of the following.
- If - SeqNTis a character vector or string scalar, then the function returns a character vector.
- If - SeqNTis a row vector of integers, then the function returns a row vector of integers. For information on valid integers, see Mapping Amino Acid Letter Codes to Integers.
- If - SeqNTis a structure, then the function returns- SeqAAwith the same data type as the- Sequencefield, either a character vector or a row vector of integers.
Setting Frame to "all" directs
            the function to return a 3-by-1 cell array.
Version History
Introduced before R2006a
See Also
aa2nt | aminolookup | baselookup | codonbias | dnds | dndsml | geneticcode | isotopicdist | revgeneticcode
MATLAB Command
You clicked a link that corresponds to this MATLAB command:
Run the command by entering it in the MATLAB Command Window. Web browsers do not support MATLAB commands.
Select a Web Site
Choose a web site to get translated content where available and see local events and offers. Based on your location, we recommend that you select: .
You can also select a web site from the following list
How to Get Best Site Performance
Select the China site (in Chinese or English) for best site performance. Other MathWorks country sites are not optimized for visits from your location.
Americas
- América Latina (Español)
- Canada (English)
- United States (English)
Europe
- Belgium (English)
- Denmark (English)
- Deutschland (Deutsch)
- España (Español)
- Finland (English)
- France (Français)
- Ireland (English)
- Italia (Italiano)
- Luxembourg (English)
- Netherlands (English)
- Norway (English)
- Österreich (Deutsch)
- Portugal (English)
- Sweden (English)
- Switzerland
- United Kingdom (English)