Answered
How to test for integers and delete integers that do not perform to the test
Hint: Take a look at the result of rem(A,1)==0. What do you get if you sum this up?

11 years ago | 1

Answered
Can anyone help me to find the mistake in this code?
Why the switch from W to V? Seems to me you should be using W all the way through. E.g., W = W(I); Z1 = W1(I).*sqrt(-2....

11 years ago | 0

| accepted

Answered
I have arrays and I want to put them in a table
Does this do what you want: mytable = table(Station_1,Station_2,Station_3,Station_4,Station_5,'RowNames',{'Pressure','Temp'...

11 years ago | 0

Answered
How to compare class type of 2 variables to find equality and use it within switch-case
What if you simply switched on the value of c? E.g., switch c Does this do what you want? Or is there something else y...

11 years ago | 0

Answered
Matrix dimensions don't agree
Try changing the division to element-wise: pred = (((K-b)*(age.^2))./((a^2)+(age.^2)))+b; % <-- Changed / to ./

11 years ago | 0

| accepted

Answered
Is it possible to make alias for a variable?
The closest thing in MATLAB to this might be a classdef object derived from handle, where multiple variables actually "point" to...

11 years ago | 0

Answered
Wrapping a MEX function that has an "ans" output in some cases
I am not on a machine with MATLAB at the moment to verify this, but I think the syntax for passing variable number of arguments ...

11 years ago | 2

| accepted

Answered
Finding rows with the closest values in two matrices matlab
E.g., not sure if this is what you want but to make B look like the order in A, keying off of the 2nd column and keeping the row...

11 years ago | 0

Answered
quat2angle function
If you run the code below, you can confirm the following with respect to the functions in the Aerospace Toolbox: The rotation...

11 years ago | 0

Answered
Relative motion between Quaternions
In general, for unit quaternions you would multiply the conjugate of one times the other, and then extract the angle and rotatio...

11 years ago | 3

Answered
Convert 8 Byte timestamp to a human readable time!
I haven't gone through your one-liner in any detail, but if you are starting with the 8 bytes shown above, then a simple typecas...

11 years ago | 0

| accepted

Answered
Decoding DNA sequence into binary
One way: s = 'TGACTCAGTCGTTCAATCTATGCC'; % Input DNA string [~,x] = ismember(s,'ATGC'); % Convert the ATGC into indexe...

11 years ago | 0

| accepted

Answered
How do i do a for loop within a for loop with a variable changing n=1:42.
Why can't you use simple if-tests on the value of n to set the value of I?

11 years ago | 0

Answered
How can you get totals from separate cell arrays?
Use cell2mat to convert them to doubles, then add them up.

11 years ago | 0

| accepted

Answered
Help with Alogrithm????
You could save the x and y result from each iteration in a vector, but rather that do that you don't really need the for loop at...

11 years ago | 0

| accepted

Answered
If I have a 4x4 cell array, 'm' where each element is a matrix expressed as '4x4 double', what would be the notation to access the values of a matrix within 'm'.
For a cell array m, m(i,j) is the i'th row, j'th column element of m. m(i,j) is a 1x1 cell array. m{i,j} is the ...

11 years ago | 1

| accepted

Answered
how to save array values in .mat file in 1 column and multiple rows instead of multiple columns in 1 row.
Transpose j before saving it. E.g., j = j.'; % <-- transpose j save('j.mat', 'j');

11 years ago | 0

| accepted

Answered
Adding the elements to next element
result = cumsum([initial_A A]);

11 years ago | 0

| accepted

Answered
Why does char give me an empty output?
Characters for ASCII codes 1, 2, 3, 4, 5 are all unprintable characters, so nothing prints. The conversion *did* take place, but...

11 years ago | 2

| accepted

Answered
Issue with random function
What is the class of the variable random? Is it a double at the command line but something else in your script?

11 years ago | 0

Answered
random number from a set of define numbers
Try this: HOT = [3,11,29,30,33,35]; OTHER = 1:37: OTHER(HOT) = []; x = randperm(6,3); y = randperm(31,3); pi...

11 years ago | 0

| accepted

Answered
Why won't my code run? Matlab just says its busy when i run it?
The f(0) looks like a typo in this line: if sign(f(a)) * sign(f(0)) < 0 As for the rest of the code, nobody is going to ...

11 years ago | 0

Answered
While Loop is not ending, just keeps repeating from top
Some slight changes: colour = {'Red','Green','Blue'} x=colour{randi(numel(colour))}; % <-- Added semi-colon so you don't...

11 years ago | 0

| accepted

Answered
How can I find the maximum deviation between two matrices?
Maybe this? max(abs(A(:)-B(:)))

11 years ago | 0

Answered
Choosing one answer from 3 in Solve
To get the real part of the 3rd element, e.g., >> x = [-1.35-4.59i , -0.136-4.59i , 1.18+9.18e-41i] x = -1.3500 - 4...

11 years ago | 0

| accepted

Answered
counting number of inputs
Use a variable as a counter. E.g., suppose the variable name was guesses. Start with guesses=0 and then do guesses=guesses+1 fo...

11 years ago | 0

Answered
How to delete a submatrix from a matrix using the ZEROS command instead of [ ] square brackets?
Using explicit brackets [ ] on the right hand side of an equation combined with using indexing on the left hand side variable is...

11 years ago | 0

Answered
how to get the value a number at a specify decimal position ?
Use sprintf, find the decimal point, then get the desired digit after the decimal point. That being said, realize that for some...

11 years ago | 0

| accepted

Answered
How to aggregate two columns
This is how one would do it if A and B are doubles: C = A*1e8 + B; However, each of A and B has 8 decimal digits, so the...

11 years ago | 0

Answered
Are there any function to check a string in the argument list?
any(cellfun(@isequal,varargin,repmat({'off'},size(varargin))))

11 years ago | 0

| accepted